A summary of ocular fundus diseases in China over the past 70 years

After 70 years of development, China has become a global leader in the academicresearch and clinical practice of fundus diseases. The dramatic progress is mainly attributable to the relentless efforts of generations of fundus ophthalmologists. We are moving forward to incorporate new technologies such as AI and big data into the treatment of fundus diseases.

The summary is intended to commemorate the past masters and to inspire the young ophthalmologists. We would like to send congratulations on the 70th anniversary of Chinese Journal of Ophthalmology with this article. (Chin J Ophthalmol, 2020, 56:241-245).

Human Albumin (ALB) ELISA Kit
DLR-ALB-Hu-48T	DL Develop	48T	EUR 348
Should the Human Albumin (ALB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Albumin (ALB) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Albumin (ALB) ELISA Kit
DLR-ALB-Hu-96T	DL Develop	96T	EUR 441
Should the Human Albumin (ALB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Albumin (ALB) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Albumin (ALB) ELISA Kit
DLR-ALB-Mu-48T	DL Develop	48T	EUR 328
Should the Mouse Albumin (ALB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Albumin (ALB) in samples from serum, plasma or other biological fluids.

Mouse Albumin (ALB) ELISA Kit
DLR-ALB-Mu-96T	DL Develop	96T	EUR 415
Should the Mouse Albumin (ALB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Albumin (ALB) in samples from serum, plasma or other biological fluids.

Rat Albumin (ALB) ELISA Kit
DLR-ALB-Ra-48T	DL Develop	48T	EUR 279
Should the Rat Albumin (ALB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Albumin (ALB) in samples from serum, plasma or other biological fluids.

Rat Albumin (ALB) ELISA Kit
DLR-ALB-Ra-96T	DL Develop	96T	EUR 346
Should the Rat Albumin (ALB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Albumin (ALB) in samples from serum, plasma or other biological fluids.

Canine Albumin (ALB) ELISA Kit
RD-ALB-c-48Tests	Reddot Biotech	48 Tests	EUR 336

Canine Albumin (ALB) ELISA Kit
RD-ALB-c-96Tests	Reddot Biotech	96 Tests	EUR 458

Human Albumin (ALB) ELISA Kit
RD-ALB-Hu-48Tests	Reddot Biotech	48 Tests	EUR 330

Human Albumin (ALB) ELISA Kit
RD-ALB-Hu-96Tests	Reddot Biotech	96 Tests	EUR 450

Mouse Albumin (ALB) ELISA Kit
RD-ALB-Mu-48Tests	Reddot Biotech	48 Tests	EUR 308

Mouse Albumin (ALB) ELISA Kit
RD-ALB-Mu-96Tests	Reddot Biotech	96 Tests	EUR 419

Rat Albumin (ALB) ELISA Kit
RD-ALB-Ra-48Tests	Reddot Biotech	48 Tests	EUR 253

Rat Albumin (ALB) ELISA Kit
RD-ALB-Ra-96Tests	Reddot Biotech	96 Tests	EUR 339

Canine Albumin (ALB) ELISA Kit
RDR-ALB-c-48Tests	Reddot Biotech	48 Tests	EUR 350

Canine Albumin (ALB) ELISA Kit
RDR-ALB-c-96Tests	Reddot Biotech	96 Tests	EUR 479

Human Albumin (ALB) ELISA Kit
RDR-ALB-Hu-48Tests	Reddot Biotech	48 Tests	EUR 344

Human Albumin (ALB) ELISA Kit
RDR-ALB-Hu-96Tests	Reddot Biotech	96 Tests	EUR 470

Mouse Albumin (ALB) ELISA Kit
RDR-ALB-Mu-48Tests	Reddot Biotech	48 Tests	EUR 321

Mouse Albumin (ALB) ELISA Kit
RDR-ALB-Mu-96Tests	Reddot Biotech	96 Tests	EUR 438

Rat Albumin (ALB) ELISA Kit
RDR-ALB-Ra-48Tests	Reddot Biotech	48 Tests	EUR 263

Rat Albumin (ALB) ELISA Kit
RDR-ALB-Ra-96Tests	Reddot Biotech	96 Tests	EUR 354

Guinea pig Albumin (ALB) ELISA Kit
DLR-ALB-Gu-48T	DL Develop	48T	EUR 322
Should the Guinea pig Albumin (ALB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Guinea pig Albumin (ALB) in samples from serum, plasma or other biological fluids.

Guinea pig Albumin (ALB) ELISA Kit
DLR-ALB-Gu-96T	DL Develop	96T	EUR 406
Should the Guinea pig Albumin (ALB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Guinea pig Albumin (ALB) in samples from serum, plasma or other biological fluids.

Guinea pig Albumin (ALB) ELISA Kit
RD-ALB-Gu-48Tests	Reddot Biotech	48 Tests	EUR 301

Guinea pig Albumin (ALB) ELISA Kit
RD-ALB-Gu-96Tests	Reddot Biotech	96 Tests	EUR 409

Guinea pig Albumin (ALB) ELISA Kit
RDR-ALB-Gu-48Tests	Reddot Biotech	48 Tests	EUR 314

Guinea pig Albumin (ALB) ELISA Kit
RDR-ALB-Gu-96Tests	Reddot Biotech	96 Tests	EUR 427

Anti-ALB/Albumin Antibody
A01245-1	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for ALB Antibody (ALB) detection.tested for IHC, WB in Human.

ALB siRNA
20-abx900267	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ALB siRNA
20-abx907214	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ALB siRNA
20-abx907215	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ALB protein
80R-4219	Fitzgerald	10 ug	EUR 349
Description: Recombinant Human ALB protein with His tag

ALB Antibody
ABD6396	Lifescience Market	100 ug	EUR 438

ALB Antibody
35541-100ul	SAB	100ul	EUR 252

ALB antibody
38231-100ul	SAB	100ul	EUR 252

ALB antibody
70R-15661	Fitzgerald	50 ul	EUR 321
Description: Rabbit polyclonal ALB antibody

ALB Antibody
DF6396	Affbiotech	200ul	EUR 304
Description: ALB Antibody detects endogenous levels of total ALB.

Alb Antibody
1-CSB-PA00010E1Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Alb. Recognizes Alb from Rat. This antibody is Unconjugated. Tested in the following application: ELISA

ALB Antibody
1-CSB-PA00020E1Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Pigeon. This antibody is Unconjugated. Tested in the following application: ELISA

ALB Antibody
1-CSB-PA00030E1Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Chicken. This antibody is Unconjugated. Tested in the following application: ELISA

ALB Antibody
1-CSB-PA00040E1Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Horse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

ALB Antibody
1-CSB-PA00050E1Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Sheep. This antibody is Unconjugated. Tested in the following application: ELISA

ALB Antibody
1-CSB-PA00060E1Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Human. This antibody is Unconjugated. Tested in the following application: ELISA

ALB Antibody
1-CSB-PA00070E0Gp	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Rabbit. This antibody is Unconjugated. Tested in the following application: ELISA

Alb Antibody
1-CSB-PA00080E1Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Alb. Recognizes Alb from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA

ALB Antibody
1-CSB-PA001561GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

ALB Antibody
1-CSB-PA001561JA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Human. This antibody is Unconjugated. Tested in the following application: ELISA

ALB Antibody
CSB-PA001561KA01HU-	Cusabio		EUR 335
Form: liquid Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against ALB. Recognizes ALB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

ALB Antibody
CSB-PA001561KA01HU-100ul	Cusabio	100ul	EUR 389
Form: liquid Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against ALB. Recognizes ALB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

ALB Antibody
1-CSB-PA001561LA01DO	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Dog. This antibody is Unconjugated. Tested in the following application: ELISA

ALB Antibody
1-CSB-PA001561LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200

ALB Antibody
1-CSB-PA001561LA01MOV	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Macaca fascicularis. This antibody is Unconjugated. Tested in the following application: ELISA

ALB Antibody
1-CSB-PA00180E1Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Goat. This antibody is Unconjugated. Tested in the following application: ELISA

ALB Antibody
1-CSB-PA00200E1Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Guinea Pig. This antibody is Unconjugated. Tested in the following application: ELISA

ALB Antibody
1-CSB-PA00210E1Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Pig. This antibody is Unconjugated. Tested in the following application: ELISA

ALB Antibody
1-CSB-PA00260E1Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Canine. This antibody is Unconjugated. Tested in the following application: ELISA

ALB Antibody
1-CSB-PA00950E1Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Bovine. This antibody is Unconjugated. Tested in the following application: ELISA

ALB Antibody
1-CSB-PA079344	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ALB. Recognizes ALB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:500-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

MAU/ALB/ Rat MAU/ ALB ELISA Kit
ELA-E1459r	Lifescience Market	96 Tests	EUR 886

ALB Conjugated Antibody
C38231	SAB	100ul	EUR 397

ALB Conjugated Antibody
C35541	SAB	100ul	EUR 397

ALB-127158(a)
HY-111398	MedChemExpress	100mg	EUR 1772

ALB Polyclonal Antibody
ES8512-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ALB from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

ALB Polyclonal Antibody
ES8512-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ALB from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Eukaryotic Albumin (ALB)
4-EPB028Hu51	Cloud-Clone	EUR 279.20 EUR 178.00 EUR 772.00 EUR 324.00 EUR 548.00 EUR 250.00 EUR 1780.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: D3ZEU5 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 66.5kDa Isoelectric Point: 5.7
Description: Recombinant Human Albumin expressed in: Yeast

Albumin (ALB) Antibody
abx117086-100ug	Abbexa	100 ug	EUR 467
Shipped within 5-10 working days.

ALB Polyclonal Antibody
ABP57519-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from ALB at AA range: 511-560 Applications tips:
Description: A polyclonal antibody for detection of ALB from Human. This ALB antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from ALB at AA range: 511-560

ALB Polyclonal Antibody
ABP57519-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from ALB at AA range: 511-560 Applications tips:
Description: A polyclonal antibody for detection of ALB from Human. This ALB antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from ALB at AA range: 511-560

ALB Polyclonal Antibody
ABP57519-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from ALB at AA range: 511-560 Applications tips:
Description: A polyclonal antibody for detection of ALB from Human. This ALB antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from ALB at AA range: 511-560

Albumin (ALB) Antibody
20-abx000044	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Albumin (ALB) Antibody
20-abx001204	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Albumin (ALB) Antibody
abx159323-100ul	Abbexa	100 ul	EUR 467
Shipped within 5-10 working days.

Albumin (ALB) Antibody
20-abx171135	Abbexa	EUR 871.00 EUR 453.00	1 mg 200 ug
Please enquire.

Albumin (ALB) Antibody
20-abx171136	Abbexa	EUR 913.00 EUR 467.00	1 mg 200 ug
Please enquire.

Albumin (ALB) Antibody
20-abx171137	Abbexa	EUR 913.00 EUR 467.00	1 mg 200 ug
Please enquire.

Albumin (ALB) Antibody
20-abx132218	Abbexa	EUR 411.00 EUR 133.00 EUR 1149.00 EUR 565.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Albumin (ALB) Antibody
20-abx132390	Abbexa	EUR 300.00 EUR 704.00 EUR 356.00 EUR 154.00 EUR 244.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-7 working days.

Albumin (ALB) Antibody
20-abx100068	Abbexa	EUR 258.00 EUR 133.00 EUR 551.00 EUR 300.00 EUR 230.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Albumin (ALB) Antibody
20-abx100070	Abbexa	EUR 286.00 EUR 133.00 EUR 690.00 EUR 356.00 EUR 244.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Albumin (ALB) Antibody
20-abx100074	Abbexa	EUR 467.00 EUR 133.00 EUR 1358.00 EUR 648.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Albumin (ALB) Antibody
20-abx100075	Abbexa	EUR 467.00 EUR 133.00 EUR 1358.00 EUR 648.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Albumin (ALB) Antibody
20-abx100076	Abbexa	EUR 467.00 EUR 133.00 EUR 1386.00 EUR 648.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Albumin (ALB) Antibody
20-abx100078	Abbexa	EUR 481.00 EUR 133.00 EUR 1442.00 EUR 676.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Albumin (ALB) Antibody
abx032860-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Albumin (ALB) Antibody
abx032860-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Albumin (ALB) Antibody
abx025443-100ul	Abbexa	100 ul	EUR 523
Shipped within 5-10 working days.

Albumin (ALB) Antibody
abx025444-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Albumin (ALB) Antibody
abx025444-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Albumin (ALB) Antibody
20-abx175300	Abbexa	EUR 411.00 EUR 133.00 EUR 1149.00 EUR 565.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Albumin (ALB) Antibody
20-abx175302	Abbexa	EUR 1177.00 EUR 578.00	1 mg 200 ug
Please enquire.

Albumin (ALB) Antibody
20-abx175303	Abbexa	EUR 1302.00 EUR 620.00	1 mg 200 ug
Please enquire.

Albumin (ALB) Antibody
20-abx318693	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Albumin (ALB) Antibody
20-abx225024	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Albumin (ALB) Antibody
20-abx225025	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

ALB Polyclonal Antibody
A56619	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

ALB Polyclonal Antibody
A55898	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

ALB Rabbit pAb
A15638-100ul	Abclonal	100 ul	EUR 308

ALB Rabbit pAb
A15638-200ul	Abclonal	200 ul	EUR 459

ALB Rabbit pAb
A15638-20ul	Abclonal	20 ul	EUR 183

ALB Rabbit pAb
A15638-50ul	Abclonal	50 ul	EUR 223

Anti-ALB Antibody
A1696-100	Biovision		EUR 479

ALB Polyclonal Antibody
46741-100ul	SAB	100ul	EUR 252

ALB Polyclonal Antibody
46741-50ul	SAB	50ul	EUR 187

ALB Blocking Peptide
DF6396-BP	Affbiotech	1mg	EUR 195

ALB cloning plasmid
CSB-CL001561HU1-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1884 Sequence: atgaagtgggtaacctttatttcccttctttttctctttagctcggcttattccaggggtgtgtttcgtcgagatgcacacaagagtgaggttgctcatcggtttaaagatttgggagaagaaaatttcaaagccttggtgttgattgcctttgctcagtatcttcagcagtgtc Show more
Description: A cloning plasmid for the ALB gene.

ALB cloning plasmid
CSB-CL001561HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1191 Sequence: atgaagtgggtaacctttatttcccttctttttctctttagctcggcttattccaggggtgtgtttcgtcgagatgcacacaagagtgaggttgctcatcggtttaaagatttgggagaagaaaatttcaaagccttggtgttgattgcctttgctcagtatcttcagcagtgtc Show more
Description: A cloning plasmid for the ALB gene.

Native Albumin (ALB)
4-NPB028Bo01	Cloud-Clone	EUR 315.04 EUR 187.00 EUR 906.40 EUR 368.80 EUR 637.60 EUR 274.00 EUR 2116.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Inquire Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): Inquire Isoelectric Point: Inquire
Description: Recombinant Bovine Albumin expressed in: Bovine

Native Albumin (ALB)
4-NPB028Ca01	Cloud-Clone	EUR 413.60 EUR 214.00 EUR 1276.00 EUR 492.00 EUR 884.00 EUR 340.00 EUR 3040.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Inquire Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 69kDa Isoelectric Point: Inquire
Description: Recombinant Dog Albumin expressed in: Dog

Native Albumin (ALB)
4-NPB028Cp01	Cloud-Clone	EUR 315.04 EUR 187.00 EUR 906.40 EUR 368.80 EUR 637.60 EUR 274.00 EUR 2116.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Inquire Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): Inquire Isoelectric Point: Inquire
Description: Recombinant Goat Albumin expressed in: Goat

Native Albumin (ALB)
4-NPB028Eq01	Cloud-Clone	EUR 368.80 EUR 202.00 EUR 1108.00 EUR 436.00 EUR 772.00 EUR 310.00 EUR 2620.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Inquire Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 69kDa Isoelectric Point: Inquire
Description: Recombinant Horse Albumin expressed in: Horse

Native Albumin (ALB)
4-NPB028Ga01	Cloud-Clone	EUR 232.61 EUR 165.00 EUR 597.28 EUR 265.76 EUR 431.52 EUR 218.00 EUR 1343.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Inquire Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 69.9kDa Isoelectric Point: 5.5
Description: Recombinant Chicken Albumin expressed in: E.coli

Native Albumin (ALB)
4-NPB028Hu01	Cloud-Clone	EUR 216.48 EUR 161.00 EUR 536.80 EUR 245.60 EUR 391.20 EUR 208.00 EUR 1192.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: D3ZEU5 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 66.4KD Isoelectric Point: Inquire
Description: Recombinant Human Albumin expressed in: Human

Native Albumin (ALB)
4-NPB028Mu01	Cloud-Clone	EUR 171.68 EUR 149.00 EUR 368.80 EUR 189.60 EUR 279.20 EUR 178.00 EUR 772.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Inquire Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): Inquire Isoelectric Point: Inquire
Description: Recombinant Mouse Albumin expressed in: Mouse

Native Albumin (ALB)
4-NPB028Po01	Cloud-Clone	EUR 306.08 EUR 185.00 EUR 872.80 EUR 357.60 EUR 615.20 EUR 268.00 EUR 2032.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Inquire Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): Inquire Isoelectric Point: Inquire
Description: Recombinant Pig Albumin expressed in: Pig

Native Albumin (ALB)
4-NPB028Po91	Cloud-Clone	EUR 458.40 EUR 226.00 EUR 1444.00 EUR 548.00 EUR 996.00 EUR 370.00 EUR 3460.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Inquire Buffer composition: PBS, pH 7.4 Form: Freeze-dried powder Predicted Molecular Mass (KD): Inquire Isoelectric Point: Inquire
Description: Recombinant Pig Native Albumin (ALB) expressed in: Pig

Native Albumin (ALB)
4-NPB028Ra01	Cloud-Clone	EUR 153.76 EUR 144.00 EUR 301.60 EUR 167.20 EUR 234.40 EUR 166.00 EUR 604.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Inquire Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): Inquire Isoelectric Point: Inquire
Description: Recombinant Rat Albumin expressed in: Rat

Native Albumin (ALB)
4-NPB028Rb01	Cloud-Clone	EUR 162.72 EUR 146.00 EUR 335.20 EUR 178.40 EUR 256.80 EUR 172.00 EUR 688.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Inquire Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 68.7kDa Isoelectric Point: 6.1
Description: Recombinant Rabbit Albumin expressed in: Rabbit

Native Albumin (ALB)
4-NPB028Si01	Cloud-Clone	EUR 306.08 EUR 185.00 EUR 872.80 EUR 357.60 EUR 615.20 EUR 268.00 EUR 2032.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Inquire Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): Inquire Isoelectric Point: Inquire
Description: Recombinant Simian Albumin expressed in: Simian

Anti-ALB antibody
STJ97823	St John's Laboratory	100 µl	EUR 234
Description: Mouse monoclonal to ALB.

Anti-ALB antibody
STJ98462	St John's Laboratory	100 µl	EUR 234
Description: Mouse monoclonal to ALB.

Anti-ALB antibody
STJ98625	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to ALB.

Anti-ALB antibody
STJ22574	St John's Laboratory	100 µl	EUR 277
Description: Albumin is a soluble, monomeric protein which comprises about one-half of the blood serum protein. Albumin functions primarily as a carrier protein for steroids, fatty acids, and thyroid hormones and plays a role in stabilizing extracellular fluid volume. Albumin is a globular unglycosylated serum protein of molecular weight 65,000. Albumin is synthesized in the liver as preproalbumin which has an N-terminal peptide that is removed before the nascent protein is released from the rough endoplasmic reticulum. The product, proalbumin, is in turn cleaved in the Golgi vesicles to produce the secreted albumin.

Anti-ALB antibody
STJ22575	St John's Laboratory	100 µl	EUR 277
Description: Albumin is a soluble, monomeric protein which comprises about one-half of the blood serum protein. Albumin functions primarily as a carrier protein for steroids, fatty acids, and thyroid hormones and plays a role in stabilizing extracellular fluid volume. Albumin is a globular unglycosylated serum protein of molecular weight 65,000. Albumin is synthesized in the liver as preproalbumin which has an N-terminal peptide that is removed before the nascent protein is released from the rough endoplasmic reticulum. The product, proalbumin, is in turn cleaved in the Golgi vesicles to produce the secreted albumin.

Anti-ALB antibody
STJ118099	St John's Laboratory	100 µl	EUR 277

ALB sgRNA CRISPR Lentivector (Human) (Target 1)
K0070302	ABM	1.0 ug DNA	EUR 154

Alb sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4366102	ABM	1.0 ug DNA	EUR 154

Alb sgRNA CRISPR Lentivector (Rat) (Target 1)
K6931502	ABM	1.0 ug DNA	EUR 154

Dog Albumin (ALB) Protein
20-abx655874	Abbexa	EUR 217.00 EUR 175.00 EUR 356.00 EUR 230.00 EUR 203.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Albumin (ALB) Protein
abx670201-1mg	Abbexa	1 mg	EUR 314
Shipped within 1 week.

Human Albumin (ALB) Protein
20-abx651466	Abbexa	EUR 411.00 EUR 217.00 EUR 1052.00 EUR 467.00 EUR 300.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Albumin (ALB) Protein
20-abx652433	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Mouse Albumin (ALB) Protein
20-abx652434	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Mouse Albumin (ALB) Protein
20-abx652435	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Rat Albumin (ALB) Protein
20-abx652436	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Dog Albumin (ALB) Protein
20-abx652437	Abbexa	EUR 648.00 EUR 272.00 EUR 1998.00 EUR 773.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Rabbit Albumin (ALB) Protein
20-abx652439	Abbexa	EUR 648.00 EUR 272.00 EUR 1998.00 EUR 773.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Rabbit Albumin (ALB) Protein
20-abx652440	Abbexa	EUR 648.00 EUR 272.00 EUR 1998.00 EUR 773.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Rat ALB shRNA Plasmid
20-abx984371	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human ALB ELISA Kit
EHA0035	Abclonal	96Tests	EUR 521

Human ALB ELISA Kit
ELA-E1028h	Lifescience Market	96 Tests	EUR 824

Goat ALB ELISA Kit
EGTA0035	Abclonal	96Tests	EUR 521

Canine ALB ELISA Kit
ECA0035	Abclonal	96Tests	EUR 521

Chicken ALB ELISA Kit
ECKA0035	Abclonal	96Tests	EUR 521

Bovine ALB ELISA Kit
EBA0035	Abclonal	96Tests	EUR 521

Anserini ALB ELISA Kit
EAA0035	Abclonal	96Tests	EUR 521

ALB ELISA KIT|Human
EF001360	Lifescience Market	96 Tests	EUR 689

Rat ALB ELISA Kit
ERA0035	Abclonal	96Tests	EUR 521

Rabbit ALB ELISA Kit
ERTA0035	Abclonal	96Tests	EUR 521

Sheep ALB ELISA Kit
ESA0035	Abclonal	96Tests	EUR 521

Porcine ALB ELISA Kit
EPA0035	Abclonal	96Tests	EUR 521

Monkey ALB ELISA Kit
EMKA0035	Abclonal	96Tests	EUR 521

Mouse ALB ELISA Kit
EMA0035	Abclonal	96Tests	EUR 521

Pig Albumin (ALB) Protein
20-abx065007	Abbexa	EUR 439.00 EUR 230.00 EUR 1191.00 EUR 509.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Serum Albumin (ALB) Antibody
20-abx109288	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Serum Albumin (ALB) Antibody
20-abx109420	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Serum Albumin (ALB) Antibody
20-abx110206	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Serum Albumin (ALB) Antibody
20-abx110207	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Serum Albumin (ALB) Antibody
20-abx110528	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Serum Albumin (ALB) Antibody
20-abx110530	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Serum Albumin (ALB) Antibody
20-abx110537	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Serum Albumin (ALB) Antibody
20-abx110584	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Serum Albumin (ALB) Antibody
20-abx110585	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Serum Albumin (ALB) Antibody
20-abx110594	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Serum Albumin (ALB) Antibody
20-abx110618	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Serum Albumin (ALB) Antibody
20-abx110620	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Serum Albumin (ALB) Antibody
20-abx110644	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Serum Albumin (ALB) Antibody
20-abx110645	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Serum Albumin (ALB) Antibody
20-abx110646	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Serum Albumin (ALB) Antibody
20-abx110647	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Cow Albumin (ALB) Protein
20-abx168573	Abbexa	EUR 453.00 EUR 230.00 EUR 1233.00 EUR 523.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Goat Albumin (ALB) Protein
20-abx168582	Abbexa	EUR 453.00 EUR 230.00 EUR 1233.00 EUR 523.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Human Albumin (ALB) Protein
20-abx168585	Abbexa	EUR 300.00 EUR 203.00 EUR 746.00 EUR 342.00 EUR 258.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse Albumin (ALB) Protein
20-abx168594	Abbexa	EUR 244.00 EUR 189.00 EUR 523.00 EUR 272.00 EUR 217.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Pig Albumin (ALB) Protein
20-abx168599	Abbexa	EUR 439.00 EUR 230.00 EUR 1191.00 EUR 509.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Rabbit Albumin (ALB) Protein
20-abx168601	Abbexa	EUR 244.00 EUR 189.00 EUR 481.00 EUR 258.00 EUR 217.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Rat Albumin (ALB) Protein
20-abx168605	Abbexa	EUR 230.00 EUR 189.00 EUR 439.00 EUR 244.00 EUR 203.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Monkey Albumin (ALB) Protein
20-abx168613	Abbexa	EUR 439.00 EUR 230.00 EUR 1191.00 EUR 509.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

human Albumin (ALB) Antibody
abx010373-100ul	Abbexa	100 ul	EUR 411
Shipped within 5-10 working days.

Albumin (ALB) Antibody (APC)
20-abx175301	Abbexa	EUR 1177.00 EUR 578.00	1 mg 200 ug
Please enquire.

Albumin (ALB) Antibody (Biotin)
20-abx273443	Abbexa	EUR 537.00 EUR 258.00 EUR 1636.00 EUR 759.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Albumin (ALB) Antibody (Biotin)
20-abx273453	Abbexa	EUR 509.00 EUR 258.00 EUR 1539.00 EUR 718.00 EUR 411.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Albumin (ALB) Antibody (FITC)
20-abx273526	Abbexa	EUR 551.00 EUR 272.00 EUR 1706.00 EUR 787.00 EUR 439.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Albumin (ALB) Antibody (FITC)
20-abx273550	Abbexa	EUR 509.00 EUR 258.00 EUR 1525.00 EUR 704.00 EUR 411.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Albumin (ALB) Antibody (FITC)
20-abx274102	Abbexa	EUR 272.00 EUR 203.00 EUR 620.00 EUR 328.00 EUR 244.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Albumin (ALB) Antibody (FITC)
20-abx274192	Abbexa	EUR 537.00 EUR 272.00 EUR 1664.00 EUR 773.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Albumin (ALB) Antibody (HRP)
20-abx274205	Abbexa	EUR 495.00 EUR 258.00 EUR 1483.00 EUR 690.00 EUR 398.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Albumin (ALB) Antibody (FITC)
20-abx274589	Abbexa	EUR 467.00 EUR 244.00 EUR 1386.00 EUR 648.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Albumin (ALB) Antibody (HRP)
20-abx312579	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Albumin (ALB) Antibody (FITC)
20-abx312580	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.