A summary of ocular fundus diseases in China over the past 70 years

After 70 years of development, China has become a global leader in the academicresearch and clinical practice of fundus diseases. The dramatic progress is mainly attributable to the relentless efforts of generations of fundus ophthalmologists. We are moving forward to incorporate new technologies such as AI and big data into the treatment of fundus diseases.

The summary is intended to commemorate the past masters and to inspire the young ophthalmologists. We would like to send congratulations on the 70th anniversary of Chinese Journal of Ophthalmology with this article. (Chin J Ophthalmol, 2020, 56:241-245).

Human Albumin (ALB) ELISA Kit

DLR-ALB-Hu-48T 48T
EUR 348
  • Should the Human Albumin (ALB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Albumin (ALB) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Albumin (ALB) ELISA Kit

DLR-ALB-Hu-96T 96T
EUR 441
  • Should the Human Albumin (ALB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Albumin (ALB) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Albumin (ALB) ELISA Kit

DLR-ALB-Mu-48T 48T
EUR 328
  • Should the Mouse Albumin (ALB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Albumin (ALB) in samples from serum, plasma or other biological fluids.

Mouse Albumin (ALB) ELISA Kit

DLR-ALB-Mu-96T 96T
EUR 415
  • Should the Mouse Albumin (ALB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Albumin (ALB) in samples from serum, plasma or other biological fluids.

Rat Albumin (ALB) ELISA Kit

DLR-ALB-Ra-48T 48T
EUR 279
  • Should the Rat Albumin (ALB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Albumin (ALB) in samples from serum, plasma or other biological fluids.

Rat Albumin (ALB) ELISA Kit

DLR-ALB-Ra-96T 96T
EUR 346
  • Should the Rat Albumin (ALB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Albumin (ALB) in samples from serum, plasma or other biological fluids.

Canine Albumin (ALB) ELISA Kit

RD-ALB-c-48Tests 48 Tests
EUR 336

Canine Albumin (ALB) ELISA Kit

RD-ALB-c-96Tests 96 Tests
EUR 458

Human Albumin (ALB) ELISA Kit

RD-ALB-Hu-48Tests 48 Tests
EUR 330

Human Albumin (ALB) ELISA Kit

RD-ALB-Hu-96Tests 96 Tests
EUR 450

Mouse Albumin (ALB) ELISA Kit

RD-ALB-Mu-48Tests 48 Tests
EUR 308

Mouse Albumin (ALB) ELISA Kit

RD-ALB-Mu-96Tests 96 Tests
EUR 419

Rat Albumin (ALB) ELISA Kit

RD-ALB-Ra-48Tests 48 Tests
EUR 253

Rat Albumin (ALB) ELISA Kit

RD-ALB-Ra-96Tests 96 Tests
EUR 339

Canine Albumin (ALB) ELISA Kit

RDR-ALB-c-48Tests 48 Tests
EUR 350

Canine Albumin (ALB) ELISA Kit

RDR-ALB-c-96Tests 96 Tests
EUR 479

Human Albumin (ALB) ELISA Kit

RDR-ALB-Hu-48Tests 48 Tests
EUR 344

Human Albumin (ALB) ELISA Kit

RDR-ALB-Hu-96Tests 96 Tests
EUR 470

Mouse Albumin (ALB) ELISA Kit

RDR-ALB-Mu-48Tests 48 Tests
EUR 321

Mouse Albumin (ALB) ELISA Kit

RDR-ALB-Mu-96Tests 96 Tests
EUR 438

Rat Albumin (ALB) ELISA Kit

RDR-ALB-Ra-48Tests 48 Tests
EUR 263

Rat Albumin (ALB) ELISA Kit

RDR-ALB-Ra-96Tests 96 Tests
EUR 354

Guinea pig Albumin (ALB) ELISA Kit

DLR-ALB-Gu-48T 48T
EUR 322
  • Should the Guinea pig Albumin (ALB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Guinea pig Albumin (ALB) in samples from serum, plasma or other biological fluids.

Guinea pig Albumin (ALB) ELISA Kit

DLR-ALB-Gu-96T 96T
EUR 406
  • Should the Guinea pig Albumin (ALB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Guinea pig Albumin (ALB) in samples from serum, plasma or other biological fluids.

Guinea pig Albumin (ALB) ELISA Kit

RD-ALB-Gu-48Tests 48 Tests
EUR 301

Guinea pig Albumin (ALB) ELISA Kit

RD-ALB-Gu-96Tests 96 Tests
EUR 409

Guinea pig Albumin (ALB) ELISA Kit

RDR-ALB-Gu-48Tests 48 Tests
EUR 314

Guinea pig Albumin (ALB) ELISA Kit

RDR-ALB-Gu-96Tests 96 Tests
EUR 427

Anti-ALB/Albumin Antibody

A01245-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for ALB Antibody (ALB) detection.tested for IHC, WB in Human.

ALB antibody

70R-15661 50 ul
EUR 321
Description: Rabbit polyclonal ALB antibody

ALB Antibody

35541-100ul 100ul
EUR 252

ALB antibody

38231-100ul 100ul
EUR 252

ALB Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Rabbit. This antibody is Unconjugated. Tested in the following application: ELISA

Alb Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Alb. Recognizes Alb from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA

ALB Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

ALB Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Human. This antibody is Unconjugated. Tested in the following application: ELISA

ALB Antibody

EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against ALB. Recognizes ALB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

ALB Antibody

CSB-PA001561KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against ALB. Recognizes ALB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

ALB Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Dog. This antibody is Unconjugated. Tested in the following application: ELISA

ALB Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200

ALB Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Macaca fascicularis. This antibody is Unconjugated. Tested in the following application: ELISA

ALB Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Goat. This antibody is Unconjugated. Tested in the following application: ELISA

ALB Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Guinea Pig. This antibody is Unconjugated. Tested in the following application: ELISA

ALB Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Pig. This antibody is Unconjugated. Tested in the following application: ELISA

Alb Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Alb. Recognizes Alb from Rat. This antibody is Unconjugated. Tested in the following application: ELISA

ALB Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Pigeon. This antibody is Unconjugated. Tested in the following application: ELISA

ALB Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Chicken. This antibody is Unconjugated. Tested in the following application: ELISA

ALB Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Horse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

ALB Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Sheep. This antibody is Unconjugated. Tested in the following application: ELISA

ALB Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Human. This antibody is Unconjugated. Tested in the following application: ELISA

ALB Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Canine. This antibody is Unconjugated. Tested in the following application: ELISA

ALB Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ALB. Recognizes ALB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:500-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

ALB Antibody

DF6396 200ul
EUR 304
Description: ALB Antibody detects endogenous levels of total ALB.

ALB protein

80R-4219 10 ug
EUR 349
Description: Recombinant Human ALB protein with His tag

ALB Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Bovine. This antibody is Unconjugated. Tested in the following application: ELISA


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ALB Antibody

ABD6396 100 ug
EUR 438


ELA-E1459r 96 Tests
EUR 886

ALB Rabbit pAb

A15638-100ul 100 ul
EUR 308

ALB Rabbit pAb

A15638-200ul 200 ul
EUR 459

ALB Rabbit pAb

A15638-20ul 20 ul
EUR 183

ALB Rabbit pAb

A15638-50ul 50 ul
EUR 223

ALB Polyclonal Antibody

46741-100ul 100ul
EUR 252

ALB Polyclonal Antibody

46741-50ul 50ul
EUR 187

ALB Blocking Peptide

DF6396-BP 1mg
EUR 195

Albumin (ALB) Antibody

abx025443-100ul 100 ul
EUR 523
  • Shipped within 5-10 working days.

Albumin (ALB) Antibody

abx025444-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Albumin (ALB) Antibody

abx025444-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Albumin (ALB) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Albumin (ALB) Antibody

  • EUR 1177.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Albumin (ALB) Antibody

  • EUR 1302.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Albumin (ALB) Antibody

  • EUR 258.00
  • EUR 133.00
  • EUR 551.00
  • EUR 300.00
  • EUR 230.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Albumin (ALB) Antibody

  • EUR 286.00
  • EUR 133.00
  • EUR 690.00
  • EUR 356.00
  • EUR 244.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Albumin (ALB) Antibody

  • EUR 467.00
  • EUR 133.00
  • EUR 1358.00
  • EUR 648.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Albumin (ALB) Antibody

  • EUR 467.00
  • EUR 133.00
  • EUR 1358.00
  • EUR 648.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Albumin (ALB) Antibody

  • EUR 467.00
  • EUR 133.00
  • EUR 1386.00
  • EUR 648.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Albumin (ALB) Antibody

  • EUR 481.00
  • EUR 133.00
  • EUR 1442.00
  • EUR 676.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Albumin (ALB) Antibody

abx117086-100ug 100 ug
EUR 467
  • Shipped within 5-10 working days.

Albumin (ALB) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Albumin (ALB) Antibody

  • EUR 300.00
  • EUR 704.00
  • EUR 356.00
  • EUR 154.00
  • EUR 244.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Albumin (ALB) Antibody

abx159323-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

Albumin (ALB) Antibody

  • EUR 871.00
  • EUR 453.00
  • 1 mg
  • 200 ug
  • Please enquire.

Albumin (ALB) Antibody

  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Albumin (ALB) Antibody

  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Albumin (ALB) Antibody

abx032860-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Albumin (ALB) Antibody

abx032860-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

ALB Conjugated Antibody

C35541 100ul
EUR 397

ALB Conjugated Antibody

C38231 100ul
EUR 397

Albumin (ALB) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Albumin (ALB) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Albumin (ALB) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

ALB cloning plasmid

CSB-CL001561HU1-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1884
  • Sequence: atgaagtgggtaacctttatttcccttctttttctctttagctcggcttattccaggggtgtgtttcgtcgagatgcacacaagagtgaggttgctcatcggtttaaagatttgggagaagaaaatttcaaagccttggtgttgattgcctttgctcagtatcttcagcagtgtc
  • Show more
Description: A cloning plasmid for the ALB gene.

ALB cloning plasmid

CSB-CL001561HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1191
  • Sequence: atgaagtgggtaacctttatttcccttctttttctctttagctcggcttattccaggggtgtgtttcgtcgagatgcacacaagagtgaggttgctcatcggtttaaagatttgggagaagaaaatttcaaagccttggtgttgattgcctttgctcagtatcttcagcagtgtc
  • Show more
Description: A cloning plasmid for the ALB gene.

ALB Polyclonal Antibody

A56619 100 µg
EUR 570.55
Description: kits suitable for this type of research

ALB Polyclonal Antibody

A55898 100 µg
EUR 570.55
Description: fast delivery possible

Anti-ALB Antibody

EUR 479

ALB Polyclonal Antibody

ABP57519-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from ALB at AA range: 511-560
  • Applications tips:
Description: A polyclonal antibody for detection of ALB from Human. This ALB antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from ALB at AA range: 511-560

ALB Polyclonal Antibody

ABP57519-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from ALB at AA range: 511-560
  • Applications tips:
Description: A polyclonal antibody for detection of ALB from Human. This ALB antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from ALB at AA range: 511-560

ALB Polyclonal Antibody

ABP57519-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from ALB at AA range: 511-560
  • Applications tips:
Description: A polyclonal antibody for detection of ALB from Human. This ALB antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from ALB at AA range: 511-560

Albumin (ALB) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Albumin (ALB) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.


HY-111398 100mg
EUR 1772

ALB Polyclonal Antibody

ES8512-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ALB from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

ALB Polyclonal Antibody

ES8512-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ALB from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Eukaryotic Albumin (ALB)

  • EUR 279.20
  • EUR 178.00
  • EUR 772.00
  • EUR 324.00
  • EUR 548.00
  • EUR 250.00
  • EUR 1780.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: D3ZEU5
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 66.5kDa
  • Isoelectric Point: 5.7
Description: Recombinant Human Albumin expressed in: Yeast

Native Albumin (ALB)

  • EUR 315.04
  • EUR 187.00
  • EUR 906.40
  • EUR 368.80
  • EUR 637.60
  • EUR 274.00
  • EUR 2116.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): Inquire
  • Isoelectric Point: Inquire
Description: Recombinant Bovine Albumin expressed in: Bovine

Native Albumin (ALB)

  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 69kDa
  • Isoelectric Point: Inquire
Description: Recombinant Dog Albumin expressed in: Dog

Native Albumin (ALB)

  • EUR 315.04
  • EUR 187.00
  • EUR 906.40
  • EUR 368.80
  • EUR 637.60
  • EUR 274.00
  • EUR 2116.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): Inquire
  • Isoelectric Point: Inquire
Description: Recombinant Goat Albumin expressed in: Goat

Native Albumin (ALB)

  • EUR 368.80
  • EUR 202.00
  • EUR 1108.00
  • EUR 436.00
  • EUR 772.00
  • EUR 310.00
  • EUR 2620.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 69kDa
  • Isoelectric Point: Inquire
Description: Recombinant Horse Albumin expressed in: Horse

Native Albumin (ALB)

  • EUR 232.61
  • EUR 165.00
  • EUR 597.28
  • EUR 265.76
  • EUR 431.52
  • EUR 218.00
  • EUR 1343.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 69.9kDa
  • Isoelectric Point: 5.5
Description: Recombinant Chicken Albumin expressed in: E.coli

Native Albumin (ALB)

  • EUR 216.48
  • EUR 161.00
  • EUR 536.80
  • EUR 245.60
  • EUR 391.20
  • EUR 208.00
  • EUR 1192.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: D3ZEU5
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 66.4KD
  • Isoelectric Point: Inquire
Description: Recombinant Human Albumin expressed in: Human

Native Albumin (ALB)

  • EUR 171.68
  • EUR 149.00
  • EUR 368.80
  • EUR 189.60
  • EUR 279.20
  • EUR 178.00
  • EUR 772.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): Inquire
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Albumin expressed in: Mouse

Native Albumin (ALB)

  • EUR 306.08
  • EUR 185.00
  • EUR 872.80
  • EUR 357.60
  • EUR 615.20
  • EUR 268.00
  • EUR 2032.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): Inquire
  • Isoelectric Point: Inquire
Description: Recombinant Pig Albumin expressed in: Pig

Native Albumin (ALB)

  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: PBS, pH 7.4
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): Inquire
  • Isoelectric Point: Inquire
Description: Recombinant Pig Native Albumin (ALB) expressed in: Pig

Native Albumin (ALB)

  • EUR 153.76
  • EUR 144.00
  • EUR 301.60
  • EUR 167.20
  • EUR 234.40
  • EUR 166.00
  • EUR 604.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): Inquire
  • Isoelectric Point: Inquire
Description: Recombinant Rat Albumin expressed in: Rat

Native Albumin (ALB)

  • EUR 162.72
  • EUR 146.00
  • EUR 335.20
  • EUR 178.40
  • EUR 256.80
  • EUR 172.00
  • EUR 688.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 68.7kDa
  • Isoelectric Point: 6.1
Description: Recombinant Rabbit Albumin expressed in: Rabbit

Native Albumin (ALB)

  • EUR 306.08
  • EUR 185.00
  • EUR 872.80
  • EUR 357.60
  • EUR 615.20
  • EUR 268.00
  • EUR 2032.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): Inquire
  • Isoelectric Point: Inquire
Description: Recombinant Simian Albumin expressed in: Simian

Anti-ALB antibody

STJ118099 100 µl
EUR 277

Anti-ALB antibody

STJ22574 100 µl
EUR 277
Description: Albumin is a soluble, monomeric protein which comprises about one-half of the blood serum protein. Albumin functions primarily as a carrier protein for steroids, fatty acids, and thyroid hormones and plays a role in stabilizing extracellular fluid volume. Albumin is a globular unglycosylated serum protein of molecular weight 65,000. Albumin is synthesized in the liver as preproalbumin which has an N-terminal peptide that is removed before the nascent protein is released from the rough endoplasmic reticulum. The product, proalbumin, is in turn cleaved in the Golgi vesicles to produce the secreted albumin.

Anti-ALB antibody

STJ22575 100 µl
EUR 277
Description: Albumin is a soluble, monomeric protein which comprises about one-half of the blood serum protein. Albumin functions primarily as a carrier protein for steroids, fatty acids, and thyroid hormones and plays a role in stabilizing extracellular fluid volume. Albumin is a globular unglycosylated serum protein of molecular weight 65,000. Albumin is synthesized in the liver as preproalbumin which has an N-terminal peptide that is removed before the nascent protein is released from the rough endoplasmic reticulum. The product, proalbumin, is in turn cleaved in the Golgi vesicles to produce the secreted albumin.

Anti-ALB antibody

STJ97823 100 µl
EUR 234
Description: Mouse monoclonal to ALB.

Anti-ALB antibody

STJ98462 100 µl
EUR 234
Description: Mouse monoclonal to ALB.

Anti-ALB antibody

STJ98625 200 µl
EUR 197
Description: Rabbit polyclonal to ALB.

Alb sgRNA CRISPR Lentivector (Rat) (Target 1)

K6931502 1.0 ug DNA
EUR 154

Alb sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4366102 1.0 ug DNA
EUR 154

ALB sgRNA CRISPR Lentivector (Human) (Target 1)

K0070302 1.0 ug DNA
EUR 154

ALB Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Rabbit. This antibody is HRP conjugated. Tested in the following application: ELISA

ALB Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Rabbit. This antibody is FITC conjugated. Tested in the following application: ELISA

ALB Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Rabbit. This antibody is Biotin conjugated. Tested in the following application: ELISA

Alb Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Alb. Recognizes Alb from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA

Alb Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Alb. Recognizes Alb from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA

Alb Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Alb. Recognizes Alb from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA

ALB Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Dog. This antibody is HRP conjugated. Tested in the following application: ELISA

ALB Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ALB Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Macaca fascicularis. This antibody is HRP conjugated. Tested in the following application: ELISA

ALB Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Dog. This antibody is FITC conjugated. Tested in the following application: ELISA

ALB Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ALB Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Macaca fascicularis. This antibody is FITC conjugated. Tested in the following application: ELISA

ALB Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Dog. This antibody is Biotin conjugated. Tested in the following application: ELISA

ALB Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

ALB Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Macaca fascicularis. This antibody is Biotin conjugated. Tested in the following application: ELISA

ALB Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Goat. This antibody is HRP conjugated. Tested in the following application: ELISA

ALB Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Goat. This antibody is FITC conjugated. Tested in the following application: ELISA

ALB Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Goat. This antibody is Biotin conjugated. Tested in the following application: ELISA

ALB Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Guinea Pig. This antibody is HRP conjugated. Tested in the following application: ELISA

ALB Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Guinea Pig. This antibody is FITC conjugated. Tested in the following application: ELISA

ALB Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Guinea Pig. This antibody is Biotin conjugated. Tested in the following application: ELISA

ALB Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Pig. This antibody is HRP conjugated. Tested in the following application: ELISA

ALB Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Pig. This antibody is FITC conjugated. Tested in the following application: ELISA

ALB Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Pig. This antibody is Biotin conjugated. Tested in the following application: ELISA

Alb Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Alb. Recognizes Alb from Rat. This antibody is HRP conjugated. Tested in the following application: ELISA

Alb Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Alb. Recognizes Alb from Rat. This antibody is FITC conjugated. Tested in the following application: ELISA

Alb Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Alb. Recognizes Alb from Rat. This antibody is Biotin conjugated. Tested in the following application: ELISA

ALB Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Pigeon. This antibody is HRP conjugated. Tested in the following application: ELISA

ALB Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Pigeon. This antibody is FITC conjugated. Tested in the following application: ELISA

ALB Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Pigeon. This antibody is Biotin conjugated. Tested in the following application: ELISA

ALB Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Chicken. This antibody is HRP conjugated. Tested in the following application: ELISA

ALB Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Chicken. This antibody is FITC conjugated. Tested in the following application: ELISA

ALB Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Chicken. This antibody is Biotin conjugated. Tested in the following application: ELISA

ALB Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Horse. This antibody is HRP conjugated. Tested in the following application: ELISA

ALB Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Horse. This antibody is FITC conjugated. Tested in the following application: ELISA

ALB Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Horse. This antibody is Biotin conjugated. Tested in the following application: ELISA

ALB Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Sheep. This antibody is HRP conjugated. Tested in the following application: ELISA

ALB Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Sheep. This antibody is FITC conjugated. Tested in the following application: ELISA

ALB Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Sheep. This antibody is Biotin conjugated. Tested in the following application: ELISA

ALB Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ALB Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ALB Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

ALB Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Canine. This antibody is HRP conjugated. Tested in the following application: ELISA

ALB Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Canine. This antibody is FITC conjugated. Tested in the following application: ELISA

ALB Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Canine. This antibody is Biotin conjugated. Tested in the following application: ELISA

Dog Serum albumin (ALB)

  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 69.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Dog Serum albumin(ALB) expressed in E.coli

Dog Serum albumin (ALB)

  • EUR 679.00
  • EUR 335.00
  • EUR 2172.00
  • EUR 1051.00
  • EUR 1442.00
  • EUR 435.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 67.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Dog Serum albumin(ALB) expressed in Yeast

Mouse Serum albumin (Alb)

  • EUR 586.00
  • EUR 299.00
  • EUR 2172.00
  • EUR 900.00
  • EUR 1442.00
  • EUR 382.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 67.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Serum albumin(Alb) expressed in Yeast

human Albumin (ALB) Antibody

abx010373-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

Albumin (ALB) Antibody (APC)

  • EUR 1177.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Serum albumin (ALB) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serum Albumin (ALB) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serum Albumin (ALB) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serum Albumin (ALB) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serum Albumin (ALB) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serum Albumin (ALB) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serum Albumin (ALB) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serum Albumin (ALB) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serum Albumin (ALB) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serum Albumin (ALB) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serum Albumin (ALB) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serum Albumin (ALB) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.