With the growing popularity and use of nicotine vaping products (NVPs), it is important that pharmacists have evidence-based information in order to provide guidance to their customers. The news media can play an important role in shaping how pharmacists think, feel and act regarding NVPs.
This paper examines how NVPs are portrayed and framed in Australian pharmacy news sources.Four leading Australian online pharmacy professional news sources were searched for articles published between 2007 and August 2019. A combination of qualitative and quantitative methods was employed to explore how the safety, efficacy and regulation of NVPs was communicated.
We identified and analysed 103 relevant articles. Academicresearch findings and/or expert opinions were either cited or referenced most often, appearing in a total of 59% of articles analysed, followed by government sources quoted in 41% of articles.
Health effects and safety issues of NVPs were the most frequently mentioned topic appearing in a total of 79% of the stories, followed by NVP-related regulatory issues (47%). The majority of NVP-related articles were framed in a loss rather than gain contexts, with more emphasis given to the concern that NVPs have the potential to addict youth to nicotine and undermine Australia’s progress in tobacco control.Australian pharmacy news media have more often reported the potential risks than the potential benefits of NVPs.
Such portrayal is likely to contribute to misperceptions about the relative harm of NVPs. Pharmacy staff need access to unbiased and evidence-based guidance on how to handle customer enquiries regarding NVPs.
Human Albumin (ALB) ELISA Kit |
DLR-ALB-Hu-48T |
DL Develop |
48T |
EUR 348 |
- Should the Human Albumin (ALB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Albumin (ALB) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Albumin (ALB) ELISA Kit |
DLR-ALB-Hu-96T |
DL Develop |
96T |
EUR 441 |
- Should the Human Albumin (ALB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Albumin (ALB) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Mouse Albumin (ALB) ELISA Kit |
DLR-ALB-Mu-48T |
DL Develop |
48T |
EUR 328 |
- Should the Mouse Albumin (ALB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Albumin (ALB) in samples from serum, plasma or other biological fluids. |
Mouse Albumin (ALB) ELISA Kit |
DLR-ALB-Mu-96T |
DL Develop |
96T |
EUR 415 |
- Should the Mouse Albumin (ALB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Albumin (ALB) in samples from serum, plasma or other biological fluids. |
Rat Albumin (ALB) ELISA Kit |
DLR-ALB-Ra-48T |
DL Develop |
48T |
EUR 279 |
- Should the Rat Albumin (ALB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Albumin (ALB) in samples from serum, plasma or other biological fluids. |
Rat Albumin (ALB) ELISA Kit |
DLR-ALB-Ra-96T |
DL Develop |
96T |
EUR 346 |
- Should the Rat Albumin (ALB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Albumin (ALB) in samples from serum, plasma or other biological fluids. |
Canine Albumin (ALB) ELISA Kit |
RD-ALB-c-48Tests |
Reddot Biotech |
48 Tests |
EUR 336 |
Canine Albumin (ALB) ELISA Kit |
RD-ALB-c-96Tests |
Reddot Biotech |
96 Tests |
EUR 458 |
Human Albumin (ALB) ELISA Kit |
RD-ALB-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 330 |
Human Albumin (ALB) ELISA Kit |
RD-ALB-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 450 |
Mouse Albumin (ALB) ELISA Kit |
RD-ALB-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 308 |
Mouse Albumin (ALB) ELISA Kit |
RD-ALB-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 419 |
Rat Albumin (ALB) ELISA Kit |
RD-ALB-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 253 |
Rat Albumin (ALB) ELISA Kit |
RD-ALB-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 339 |
Canine Albumin (ALB) ELISA Kit |
RDR-ALB-c-48Tests |
Reddot Biotech |
48 Tests |
EUR 350 |
Canine Albumin (ALB) ELISA Kit |
RDR-ALB-c-96Tests |
Reddot Biotech |
96 Tests |
EUR 479 |
Human Albumin (ALB) ELISA Kit |
RDR-ALB-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 344 |
Human Albumin (ALB) ELISA Kit |
RDR-ALB-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 470 |
Mouse Albumin (ALB) ELISA Kit |
RDR-ALB-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 321 |
Mouse Albumin (ALB) ELISA Kit |
RDR-ALB-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 438 |
Rat Albumin (ALB) ELISA Kit |
RDR-ALB-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 263 |
Rat Albumin (ALB) ELISA Kit |
RDR-ALB-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 354 |
Guinea pig Albumin (ALB) ELISA Kit |
DLR-ALB-Gu-48T |
DL Develop |
48T |
EUR 322 |
- Should the Guinea pig Albumin (ALB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Guinea pig Albumin (ALB) in samples from serum, plasma or other biological fluids. |
Guinea pig Albumin (ALB) ELISA Kit |
DLR-ALB-Gu-96T |
DL Develop |
96T |
EUR 406 |
- Should the Guinea pig Albumin (ALB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Guinea pig Albumin (ALB) in samples from serum, plasma or other biological fluids. |
Guinea pig Albumin (ALB) ELISA Kit |
RD-ALB-Gu-48Tests |
Reddot Biotech |
48 Tests |
EUR 301 |
Guinea pig Albumin (ALB) ELISA Kit |
RD-ALB-Gu-96Tests |
Reddot Biotech |
96 Tests |
EUR 409 |
Guinea pig Albumin (ALB) ELISA Kit |
RDR-ALB-Gu-48Tests |
Reddot Biotech |
48 Tests |
EUR 314 |
Guinea pig Albumin (ALB) ELISA Kit |
RDR-ALB-Gu-96Tests |
Reddot Biotech |
96 Tests |
EUR 427 |
ALB siRNA |
20-abx900267 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ALB siRNA |
20-abx907214 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ALB siRNA |
20-abx907215 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ALB protein |
80R-4219 |
Fitzgerald |
10 ug |
EUR 349 |
Description: Recombinant Human ALB protein with His tag |
ALB Antibody |
35541-100ul |
SAB |
100ul |
EUR 252 |
ALB antibody |
38231-100ul |
SAB |
100ul |
EUR 252 |
ALB antibody |
70R-15661 |
Fitzgerald |
50 ul |
EUR 321 |
Description: Rabbit polyclonal ALB antibody |
ALB Antibody |
DF6396 |
Affbiotech |
200ul |
EUR 304 |
Description: ALB Antibody detects endogenous levels of total ALB. |
Alb Antibody |
1-CSB-PA00010E1Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Alb. Recognizes Alb from Rat. This antibody is Unconjugated. Tested in the following application: ELISA |
ALB Antibody |
1-CSB-PA00020E1Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ALB. Recognizes ALB from Pigeon. This antibody is Unconjugated. Tested in the following application: ELISA |
ALB Antibody |
1-CSB-PA00030E1Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ALB. Recognizes ALB from Chicken. This antibody is Unconjugated. Tested in the following application: ELISA |
ALB Antibody |
1-CSB-PA00040E1Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ALB. Recognizes ALB from Horse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000 |
ALB Antibody |
1-CSB-PA00050E1Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ALB. Recognizes ALB from Sheep. This antibody is Unconjugated. Tested in the following application: ELISA |
ALB Antibody |
1-CSB-PA00060E1Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ALB. Recognizes ALB from Human. This antibody is Unconjugated. Tested in the following application: ELISA |
ALB Antibody |
1-CSB-PA00070E0Gp |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ALB. Recognizes ALB from Rabbit. This antibody is Unconjugated. Tested in the following application: ELISA |
Alb Antibody |
1-CSB-PA00080E1Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Alb. Recognizes Alb from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA |
ALB Antibody |
1-CSB-PA001561GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against ALB. Recognizes ALB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC |
ALB Antibody |
1-CSB-PA001561JA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ALB. Recognizes ALB from Human. This antibody is Unconjugated. Tested in the following application: ELISA |
ALB Antibody |
CSB-PA001561KA01HU- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
|
Description: A polyclonal antibody against ALB. Recognizes ALB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200 |
ALB Antibody |
CSB-PA001561KA01HU-100ul |
Cusabio |
100ul |
EUR 389 |
- Form: liquid
- Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
|
Description: A polyclonal antibody against ALB. Recognizes ALB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200 |
ALB Antibody |
1-CSB-PA001561LA01DO |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ALB. Recognizes ALB from Dog. This antibody is Unconjugated. Tested in the following application: ELISA |
ALB Antibody |
1-CSB-PA001561LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ALB. Recognizes ALB from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200 |
ALB Antibody |
1-CSB-PA001561LA01MOV |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ALB. Recognizes ALB from Macaca fascicularis. This antibody is Unconjugated. Tested in the following application: ELISA |
ALB Antibody |
1-CSB-PA00180E1Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ALB. Recognizes ALB from Goat. This antibody is Unconjugated. Tested in the following application: ELISA |
ALB Antibody |
1-CSB-PA00200E1Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ALB. Recognizes ALB from Guinea Pig. This antibody is Unconjugated. Tested in the following application: ELISA |
ALB Antibody |
1-CSB-PA00210E1Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ALB. Recognizes ALB from Pig. This antibody is Unconjugated. Tested in the following application: ELISA |
ALB Antibody |
1-CSB-PA00260E1Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ALB. Recognizes ALB from Canine. This antibody is Unconjugated. Tested in the following application: ELISA |
ALB Antibody |
1-CSB-PA00950E1Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ALB. Recognizes ALB from Bovine. This antibody is Unconjugated. Tested in the following application: ELISA |
ALB Antibody |
1-CSB-PA079344 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against ALB. Recognizes ALB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:500-1:5000, WB:1:500-1:2000, IHC:1:25-1:100 |
ALB sgRNA CRISPR Lentivector (Human) (Target 2) |
K0070303 |
ABM |
1.0 ug DNA |
EUR 154 |
Alb sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4366103 |
ABM |
1.0 ug DNA |
EUR 154 |
Alb sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6931503 |
ABM |
1.0 ug DNA |
EUR 154 |
ALB Conjugated Antibody |
C38231 |
SAB |
100ul |
EUR 397 |
ALB Conjugated Antibody |
C35541 |
SAB |
100ul |
EUR 397 |
ALB Polyclonal Antibody |
ES8512-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ALB from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
ALB Polyclonal Antibody |
ES8512-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ALB from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
Eukaryotic Albumin (ALB) |
4-EPB028Hu51 |
Cloud-Clone |
-
EUR 279.20
-
EUR 178.00
-
EUR 772.00
-
EUR 324.00
-
EUR 548.00
-
EUR 250.00
-
EUR 1780.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: D3ZEU5
- Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 66.5kDa
- Isoelectric Point: 5.7
|
Description: Recombinant Human Albumin expressed in: Yeast |
Albumin (ALB) Antibody |
abx117086-100ug |
Abbexa |
100 ug |
EUR 467 |
- Shipped within 5-10 working days.
|
ALB Polyclonal Antibody |
ABP57519-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from ALB at AA range: 511-560
- Applications tips:
|
Description: A polyclonal antibody for detection of ALB from Human. This ALB antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from ALB at AA range: 511-560 |
ALB Polyclonal Antibody |
ABP57519-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from ALB at AA range: 511-560
- Applications tips:
|
Description: A polyclonal antibody for detection of ALB from Human. This ALB antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from ALB at AA range: 511-560 |
ALB Polyclonal Antibody |
ABP57519-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from ALB at AA range: 511-560
- Applications tips:
|
Description: A polyclonal antibody for detection of ALB from Human. This ALB antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from ALB at AA range: 511-560 |
Albumin (ALB) Antibody |
20-abx000044 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Albumin (ALB) Antibody |
20-abx001204 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Albumin (ALB) Antibody |
abx159323-100ul |
Abbexa |
100 ul |
EUR 467 |
- Shipped within 5-10 working days.
|
Albumin (ALB) Antibody |
20-abx171135 |
Abbexa |
|
|
|
Albumin (ALB) Antibody |
20-abx171136 |
Abbexa |
|
|
|
Albumin (ALB) Antibody |
20-abx171137 |
Abbexa |
|
|
|
Albumin (ALB) Antibody |
20-abx132218 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1149.00
-
EUR 565.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Albumin (ALB) Antibody |
20-abx132390 |
Abbexa |
-
EUR 300.00
-
EUR 704.00
-
EUR 356.00
-
EUR 154.00
-
EUR 244.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Albumin (ALB) Antibody |
20-abx100068 |
Abbexa |
-
EUR 258.00
-
EUR 133.00
-
EUR 551.00
-
EUR 300.00
-
EUR 230.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Albumin (ALB) Antibody |
20-abx100070 |
Abbexa |
-
EUR 286.00
-
EUR 133.00
-
EUR 690.00
-
EUR 356.00
-
EUR 244.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Albumin (ALB) Antibody |
20-abx100074 |
Abbexa |
-
EUR 467.00
-
EUR 133.00
-
EUR 1358.00
-
EUR 648.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Albumin (ALB) Antibody |
20-abx100075 |
Abbexa |
-
EUR 467.00
-
EUR 133.00
-
EUR 1358.00
-
EUR 648.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Albumin (ALB) Antibody |
20-abx100076 |
Abbexa |
-
EUR 467.00
-
EUR 133.00
-
EUR 1386.00
-
EUR 648.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Albumin (ALB) Antibody |
20-abx100078 |
Abbexa |
-
EUR 481.00
-
EUR 133.00
-
EUR 1442.00
-
EUR 676.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Albumin (ALB) Antibody |
abx032860-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Albumin (ALB) Antibody |
abx032860-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Albumin (ALB) Antibody |
abx025443-100ul |
Abbexa |
100 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Albumin (ALB) Antibody |
abx025444-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Albumin (ALB) Antibody |
abx025444-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Albumin (ALB) Antibody |
20-abx175300 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1149.00
-
EUR 565.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Albumin (ALB) Antibody |
20-abx175302 |
Abbexa |
|
|
|
Albumin (ALB) Antibody |
20-abx175303 |
Abbexa |
|
|
|
Albumin (ALB) Antibody |
20-abx318693 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Albumin (ALB) Antibody |
20-abx225024 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Albumin (ALB) Antibody |
20-abx225025 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
ALB Polyclonal Antibody |
A56619 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
ALB Polyclonal Antibody |
A55898 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
ALB Rabbit pAb |
A15638-100ul |
Abclonal |
100 ul |
EUR 308 |
ALB Rabbit pAb |
A15638-200ul |
Abclonal |
200 ul |
EUR 459 |
ALB Rabbit pAb |
A15638-20ul |
Abclonal |
20 ul |
EUR 183 |
ALB Rabbit pAb |
A15638-50ul |
Abclonal |
50 ul |
EUR 223 |
Anti-ALB Antibody |
A1696-100 |
Biovision |
|
EUR 479 |
ALB Polyclonal Antibody |
46741-100ul |
SAB |
100ul |
EUR 252 |
ALB Polyclonal Antibody |
46741-50ul |
SAB |
50ul |
EUR 187 |
ALB Blocking Peptide |
DF6396-BP |
Affbiotech |
1mg |
EUR 195 |
ALB cloning plasmid |
CSB-CL001561HU1-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1884
- Sequence: atgaagtgggtaacctttatttcccttctttttctctttagctcggcttattccaggggtgtgtttcgtcgagatgcacacaagagtgaggttgctcatcggtttaaagatttgggagaagaaaatttcaaagccttggtgttgattgcctttgctcagtatcttcagcagtgtc
- Show more
|
Description: A cloning plasmid for the ALB gene. |
ALB cloning plasmid |
CSB-CL001561HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1191
- Sequence: atgaagtgggtaacctttatttcccttctttttctctttagctcggcttattccaggggtgtgtttcgtcgagatgcacacaagagtgaggttgctcatcggtttaaagatttgggagaagaaaatttcaaagccttggtgttgattgcctttgctcagtatcttcagcagtgtc
- Show more
|
Description: A cloning plasmid for the ALB gene. |
Native Albumin (ALB) |
4-NPB028Bo01 |
Cloud-Clone |
-
EUR 315.04
-
EUR 187.00
-
EUR 906.40
-
EUR 368.80
-
EUR 637.60
-
EUR 274.00
-
EUR 2116.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Inquire
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): Inquire
- Isoelectric Point: Inquire
|
Description: Recombinant Bovine Albumin expressed in: Bovine |
Native Albumin (ALB) |
4-NPB028Ca01 |
Cloud-Clone |
-
EUR 413.60
-
EUR 214.00
-
EUR 1276.00
-
EUR 492.00
-
EUR 884.00
-
EUR 340.00
-
EUR 3040.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Inquire
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 69kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Dog Albumin expressed in: Dog |
Native Albumin (ALB) |
4-NPB028Cp01 |
Cloud-Clone |
-
EUR 315.04
-
EUR 187.00
-
EUR 906.40
-
EUR 368.80
-
EUR 637.60
-
EUR 274.00
-
EUR 2116.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Inquire
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): Inquire
- Isoelectric Point: Inquire
|
Description: Recombinant Goat Albumin expressed in: Goat |
Native Albumin (ALB) |
4-NPB028Eq01 |
Cloud-Clone |
-
EUR 368.80
-
EUR 202.00
-
EUR 1108.00
-
EUR 436.00
-
EUR 772.00
-
EUR 310.00
-
EUR 2620.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Inquire
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 69kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Horse Albumin expressed in: Horse |
Native Albumin (ALB) |
4-NPB028Ga01 |
Cloud-Clone |
-
EUR 232.61
-
EUR 165.00
-
EUR 597.28
-
EUR 265.76
-
EUR 431.52
-
EUR 218.00
-
EUR 1343.20
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Inquire
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 69.9kDa
- Isoelectric Point: 5.5
|
Description: Recombinant Chicken Albumin expressed in: E.coli |
Native Albumin (ALB) |
4-NPB028Hu01 |
Cloud-Clone |
-
EUR 216.48
-
EUR 161.00
-
EUR 536.80
-
EUR 245.60
-
EUR 391.20
-
EUR 208.00
-
EUR 1192.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: D3ZEU5
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 66.4KD
- Isoelectric Point: Inquire
|
Description: Recombinant Human Albumin expressed in: Human |
Native Albumin (ALB) |
4-NPB028Mu01 |
Cloud-Clone |
-
EUR 171.68
-
EUR 149.00
-
EUR 368.80
-
EUR 189.60
-
EUR 279.20
-
EUR 178.00
-
EUR 772.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Inquire
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): Inquire
- Isoelectric Point: Inquire
|
Description: Recombinant Mouse Albumin expressed in: Mouse |
Native Albumin (ALB) |
4-NPB028Po01 |
Cloud-Clone |
-
EUR 306.08
-
EUR 185.00
-
EUR 872.80
-
EUR 357.60
-
EUR 615.20
-
EUR 268.00
-
EUR 2032.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Inquire
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): Inquire
- Isoelectric Point: Inquire
|
Description: Recombinant Pig Albumin expressed in: Pig |
Native Albumin (ALB) |
4-NPB028Po91 |
Cloud-Clone |
-
EUR 458.40
-
EUR 226.00
-
EUR 1444.00
-
EUR 548.00
-
EUR 996.00
-
EUR 370.00
-
EUR 3460.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Inquire
- Buffer composition: PBS, pH 7.4
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): Inquire
- Isoelectric Point: Inquire
|
Description: Recombinant Pig Native Albumin (ALB) expressed in: Pig |
Native Albumin (ALB) |
4-NPB028Ra01 |
Cloud-Clone |
-
EUR 153.76
-
EUR 144.00
-
EUR 301.60
-
EUR 167.20
-
EUR 234.40
-
EUR 166.00
-
EUR 604.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Inquire
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): Inquire
- Isoelectric Point: Inquire
|
Description: Recombinant Rat Albumin expressed in: Rat |
Native Albumin (ALB) |
4-NPB028Rb01 |
Cloud-Clone |
-
EUR 162.72
-
EUR 146.00
-
EUR 335.20
-
EUR 178.40
-
EUR 256.80
-
EUR 172.00
-
EUR 688.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Inquire
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 68.7kDa
- Isoelectric Point: 6.1
|
Description: Recombinant Rabbit Albumin expressed in: Rabbit |
Native Albumin (ALB) |
4-NPB028Si01 |
Cloud-Clone |
-
EUR 306.08
-
EUR 185.00
-
EUR 872.80
-
EUR 357.60
-
EUR 615.20
-
EUR 268.00
-
EUR 2032.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Inquire
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): Inquire
- Isoelectric Point: Inquire
|
Description: Recombinant Simian Albumin expressed in: Simian |
Anti-ALB antibody |
STJ97823 |
St John's Laboratory |
100 µl |
EUR 234 |
Description: Mouse monoclonal to ALB. |
Anti-ALB antibody |
STJ98462 |
St John's Laboratory |
100 µl |
EUR 234 |
Description: Mouse monoclonal to ALB. |
Anti-ALB antibody |
STJ98625 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to ALB. |
Anti-ALB antibody |
STJ22574 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Albumin is a soluble, monomeric protein which comprises about one-half of the blood serum protein. Albumin functions primarily as a carrier protein for steroids, fatty acids, and thyroid hormones and plays a role in stabilizing extracellular fluid volume. Albumin is a globular unglycosylated serum protein of molecular weight 65,000. Albumin is synthesized in the liver as preproalbumin which has an N-terminal peptide that is removed before the nascent protein is released from the rough endoplasmic reticulum. The product, proalbumin, is in turn cleaved in the Golgi vesicles to produce the secreted albumin. |
Anti-ALB antibody |
STJ22575 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Albumin is a soluble, monomeric protein which comprises about one-half of the blood serum protein. Albumin functions primarily as a carrier protein for steroids, fatty acids, and thyroid hormones and plays a role in stabilizing extracellular fluid volume. Albumin is a globular unglycosylated serum protein of molecular weight 65,000. Albumin is synthesized in the liver as preproalbumin which has an N-terminal peptide that is removed before the nascent protein is released from the rough endoplasmic reticulum. The product, proalbumin, is in turn cleaved in the Golgi vesicles to produce the secreted albumin. |
2-Propyl-β-D-glucuronide, 2 mg |
0904-2 |
AthenaES |
2 mg |
EUR 162 |
Dog Albumin (ALB) Protein |
20-abx655874 |
Abbexa |
-
EUR 217.00
-
EUR 175.00
-
EUR 356.00
-
EUR 230.00
-
EUR 203.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Albumin (ALB) Protein |
abx670201-1mg |
Abbexa |
1 mg |
EUR 314 |
|
Human Albumin (ALB) Protein |
20-abx651466 |
Abbexa |
-
EUR 411.00
-
EUR 217.00
-
EUR 1052.00
-
EUR 467.00
-
EUR 300.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Albumin (ALB) Protein |
20-abx652433 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Mouse Albumin (ALB) Protein |
20-abx652434 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Mouse Albumin (ALB) Protein |
20-abx652435 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Rat Albumin (ALB) Protein |
20-abx652436 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Dog Albumin (ALB) Protein |
20-abx652437 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1998.00
-
EUR 773.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Rabbit Albumin (ALB) Protein |
20-abx652439 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1998.00
-
EUR 773.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Rabbit Albumin (ALB) Protein |
20-abx652440 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1998.00
-
EUR 773.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Rat ALB shRNA Plasmid |
20-abx984371 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human ALB ELISA Kit |
EHA0035 |
Abclonal |
96Tests |
EUR 521 |
Goat ALB ELISA Kit |
EGTA0035 |
Abclonal |
96Tests |
EUR 521 |
Canine ALB ELISA Kit |
ECA0035 |
Abclonal |
96Tests |
EUR 521 |
Chicken ALB ELISA Kit |
ECKA0035 |
Abclonal |
96Tests |
EUR 521 |
Bovine ALB ELISA Kit |
EBA0035 |
Abclonal |
96Tests |
EUR 521 |
Anserini ALB ELISA Kit |
EAA0035 |
Abclonal |
96Tests |
EUR 521 |
Rat ALB ELISA Kit |
ERA0035 |
Abclonal |
96Tests |
EUR 521 |
Rabbit ALB ELISA Kit |
ERTA0035 |
Abclonal |
96Tests |
EUR 521 |
Sheep ALB ELISA Kit |
ESA0035 |
Abclonal |
96Tests |
EUR 521 |
Porcine ALB ELISA Kit |
EPA0035 |
Abclonal |
96Tests |
EUR 521 |
Monkey ALB ELISA Kit |
EMKA0035 |
Abclonal |
96Tests |
EUR 521 |
Mouse ALB ELISA Kit |
EMA0035 |
Abclonal |
96Tests |
EUR 521 |
Pig Albumin (ALB) Protein |
20-abx065007 |
Abbexa |
-
EUR 439.00
-
EUR 230.00
-
EUR 1191.00
-
EUR 509.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Serum Albumin (ALB) Antibody |
20-abx109288 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Serum Albumin (ALB) Antibody |
20-abx109420 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Serum Albumin (ALB) Antibody |
20-abx110206 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Serum Albumin (ALB) Antibody |
20-abx110207 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Serum Albumin (ALB) Antibody |
20-abx110528 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Serum Albumin (ALB) Antibody |
20-abx110530 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Serum Albumin (ALB) Antibody |
20-abx110537 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Serum Albumin (ALB) Antibody |
20-abx110584 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Serum Albumin (ALB) Antibody |
20-abx110585 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Serum Albumin (ALB) Antibody |
20-abx110594 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Serum Albumin (ALB) Antibody |
20-abx110618 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Serum Albumin (ALB) Antibody |
20-abx110620 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Serum Albumin (ALB) Antibody |
20-abx110644 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Serum Albumin (ALB) Antibody |
20-abx110645 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Serum Albumin (ALB) Antibody |
20-abx110646 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Serum Albumin (ALB) Antibody |
20-abx110647 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Cow Albumin (ALB) Protein |
20-abx168573 |
Abbexa |
-
EUR 453.00
-
EUR 230.00
-
EUR 1233.00
-
EUR 523.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Goat Albumin (ALB) Protein |
20-abx168582 |
Abbexa |
-
EUR 453.00
-
EUR 230.00
-
EUR 1233.00
-
EUR 523.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Human Albumin (ALB) Protein |
20-abx168585 |
Abbexa |
-
EUR 300.00
-
EUR 203.00
-
EUR 746.00
-
EUR 342.00
-
EUR 258.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Mouse Albumin (ALB) Protein |
20-abx168594 |
Abbexa |
-
EUR 244.00
-
EUR 189.00
-
EUR 523.00
-
EUR 272.00
-
EUR 217.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Pig Albumin (ALB) Protein |
20-abx168599 |
Abbexa |
-
EUR 439.00
-
EUR 230.00
-
EUR 1191.00
-
EUR 509.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Rabbit Albumin (ALB) Protein |
20-abx168601 |
Abbexa |
-
EUR 244.00
-
EUR 189.00
-
EUR 481.00
-
EUR 258.00
-
EUR 217.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Rat Albumin (ALB) Protein |
20-abx168605 |
Abbexa |
-
EUR 230.00
-
EUR 189.00
-
EUR 439.00
-
EUR 244.00
-
EUR 203.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Monkey Albumin (ALB) Protein |
20-abx168613 |
Abbexa |
-
EUR 439.00
-
EUR 230.00
-
EUR 1191.00
-
EUR 509.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
human Albumin (ALB) Antibody |
abx010373-100ul |
Abbexa |
100 ul |
EUR 411 |
- Shipped within 5-10 working days.
|
Albumin (ALB) Antibody (APC) |
20-abx175301 |
Abbexa |
|
|
|
Albumin (ALB) Antibody (Biotin) |
20-abx273443 |
Abbexa |
-
EUR 537.00
-
EUR 258.00
-
EUR 1636.00
-
EUR 759.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Albumin (ALB) Antibody (Biotin) |
20-abx273453 |
Abbexa |
-
EUR 509.00
-
EUR 258.00
-
EUR 1539.00
-
EUR 718.00
-
EUR 411.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Albumin (ALB) Antibody (FITC) |
20-abx273526 |
Abbexa |
-
EUR 551.00
-
EUR 272.00
-
EUR 1706.00
-
EUR 787.00
-
EUR 439.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Albumin (ALB) Antibody (FITC) |
20-abx273550 |
Abbexa |
-
EUR 509.00
-
EUR 258.00
-
EUR 1525.00
-
EUR 704.00
-
EUR 411.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Albumin (ALB) Antibody (FITC) |
20-abx274102 |
Abbexa |
-
EUR 272.00
-
EUR 203.00
-
EUR 620.00
-
EUR 328.00
-
EUR 244.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Albumin (ALB) Antibody (FITC) |
20-abx274192 |
Abbexa |
-
EUR 537.00
-
EUR 272.00
-
EUR 1664.00
-
EUR 773.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Albumin (ALB) Antibody (HRP) |
20-abx274205 |
Abbexa |
-
EUR 495.00
-
EUR 258.00
-
EUR 1483.00
-
EUR 690.00
-
EUR 398.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Albumin (ALB) Antibody (FITC) |
20-abx274589 |
Abbexa |
-
EUR 467.00
-
EUR 244.00
-
EUR 1386.00
-
EUR 648.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Albumin (ALB) Antibody (HRP) |
20-abx312579 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Albumin (ALB) Antibody (FITC) |
20-abx312580 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|