How are nicotine vaping products represented to pharmacists? A content analysis of Australian pharmacy news sources.

With the growing popularity and use of nicotine vaping products (NVPs), it is important that pharmacists have evidence-based information in order to provide guidance to their customers. The news media can play an important role in shaping how pharmacists think, feel and act regarding NVPs.

This paper examines how NVPs are portrayed and framed in Australian pharmacy news sources.Four leading Australian online pharmacy professional news sources were searched for articles published between 2007 and August 2019. A combination of qualitative and quantitative methods was employed to explore how the safety, efficacy and regulation of NVPs was communicated.

We identified and analysed 103 relevant articles. Academicresearch findings and/or expert opinions were either cited or referenced most often, appearing in a total of 59% of articles analysed, followed by government sources quoted in 41% of articles.

Health effects and safety issues of NVPs were the most frequently mentioned topic appearing in a total of 79% of the stories, followed by NVP-related regulatory issues (47%). The majority of NVP-related articles were framed in a loss rather than gain contexts, with more emphasis given to the concern that NVPs have the potential to addict youth to nicotine and undermine Australia’s progress in tobacco control.Australian pharmacy news media have more often reported the potential risks than the potential benefits of NVPs.

Such portrayal is likely to contribute to misperceptions about the relative harm of NVPs. Pharmacy staff need access to unbiased and evidence-based guidance on how to handle customer enquiries regarding NVPs.

Human Albumin (ALB) ELISA Kit

DLR-ALB-Hu-48T 48T
EUR 348
  • Should the Human Albumin (ALB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Albumin (ALB) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Albumin (ALB) ELISA Kit

DLR-ALB-Hu-96T 96T
EUR 441
  • Should the Human Albumin (ALB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Albumin (ALB) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Albumin (ALB) ELISA Kit

DLR-ALB-Mu-48T 48T
EUR 328
  • Should the Mouse Albumin (ALB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Albumin (ALB) in samples from serum, plasma or other biological fluids.

Mouse Albumin (ALB) ELISA Kit

DLR-ALB-Mu-96T 96T
EUR 415
  • Should the Mouse Albumin (ALB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Albumin (ALB) in samples from serum, plasma or other biological fluids.

Rat Albumin (ALB) ELISA Kit

DLR-ALB-Ra-48T 48T
EUR 279
  • Should the Rat Albumin (ALB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Albumin (ALB) in samples from serum, plasma or other biological fluids.

Rat Albumin (ALB) ELISA Kit

DLR-ALB-Ra-96T 96T
EUR 346
  • Should the Rat Albumin (ALB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Albumin (ALB) in samples from serum, plasma or other biological fluids.

Canine Albumin (ALB) ELISA Kit

RD-ALB-c-48Tests 48 Tests
EUR 336

Canine Albumin (ALB) ELISA Kit

RD-ALB-c-96Tests 96 Tests
EUR 458

Human Albumin (ALB) ELISA Kit

RD-ALB-Hu-48Tests 48 Tests
EUR 330

Human Albumin (ALB) ELISA Kit

RD-ALB-Hu-96Tests 96 Tests
EUR 450

Mouse Albumin (ALB) ELISA Kit

RD-ALB-Mu-48Tests 48 Tests
EUR 308

Mouse Albumin (ALB) ELISA Kit

RD-ALB-Mu-96Tests 96 Tests
EUR 419

Rat Albumin (ALB) ELISA Kit

RD-ALB-Ra-48Tests 48 Tests
EUR 253

Rat Albumin (ALB) ELISA Kit

RD-ALB-Ra-96Tests 96 Tests
EUR 339

Canine Albumin (ALB) ELISA Kit

RDR-ALB-c-48Tests 48 Tests
EUR 350

Canine Albumin (ALB) ELISA Kit

RDR-ALB-c-96Tests 96 Tests
EUR 479

Human Albumin (ALB) ELISA Kit

RDR-ALB-Hu-48Tests 48 Tests
EUR 344

Human Albumin (ALB) ELISA Kit

RDR-ALB-Hu-96Tests 96 Tests
EUR 470

Mouse Albumin (ALB) ELISA Kit

RDR-ALB-Mu-48Tests 48 Tests
EUR 321

Mouse Albumin (ALB) ELISA Kit

RDR-ALB-Mu-96Tests 96 Tests
EUR 438

Rat Albumin (ALB) ELISA Kit

RDR-ALB-Ra-48Tests 48 Tests
EUR 263

Rat Albumin (ALB) ELISA Kit

RDR-ALB-Ra-96Tests 96 Tests
EUR 354

Guinea pig Albumin (ALB) ELISA Kit

DLR-ALB-Gu-48T 48T
EUR 322
  • Should the Guinea pig Albumin (ALB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Guinea pig Albumin (ALB) in samples from serum, plasma or other biological fluids.

Guinea pig Albumin (ALB) ELISA Kit

DLR-ALB-Gu-96T 96T
EUR 406
  • Should the Guinea pig Albumin (ALB) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Guinea pig Albumin (ALB) in samples from serum, plasma or other biological fluids.

Guinea pig Albumin (ALB) ELISA Kit

RD-ALB-Gu-48Tests 48 Tests
EUR 301

Guinea pig Albumin (ALB) ELISA Kit

RD-ALB-Gu-96Tests 96 Tests
EUR 409

Guinea pig Albumin (ALB) ELISA Kit

RDR-ALB-Gu-48Tests 48 Tests
EUR 314

Guinea pig Albumin (ALB) ELISA Kit

RDR-ALB-Gu-96Tests 96 Tests
EUR 427


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ALB protein

80R-4219 10 ug
EUR 349
Description: Recombinant Human ALB protein with His tag

ALB Antibody

ABD6396 100 ug
EUR 438

ALB Antibody

35541-100ul 100ul
EUR 252

ALB antibody

38231-100ul 100ul
EUR 252

ALB antibody

70R-15661 50 ul
EUR 321
Description: Rabbit polyclonal ALB antibody

ALB Antibody

DF6396 200ul
EUR 304
Description: ALB Antibody detects endogenous levels of total ALB.

Alb Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Alb. Recognizes Alb from Rat. This antibody is Unconjugated. Tested in the following application: ELISA

ALB Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Pigeon. This antibody is Unconjugated. Tested in the following application: ELISA

ALB Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Chicken. This antibody is Unconjugated. Tested in the following application: ELISA

ALB Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Horse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

ALB Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Sheep. This antibody is Unconjugated. Tested in the following application: ELISA

ALB Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Human. This antibody is Unconjugated. Tested in the following application: ELISA

ALB Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Rabbit. This antibody is Unconjugated. Tested in the following application: ELISA

Alb Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Alb. Recognizes Alb from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA

ALB Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

ALB Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Human. This antibody is Unconjugated. Tested in the following application: ELISA

ALB Antibody

EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against ALB. Recognizes ALB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

ALB Antibody

CSB-PA001561KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against ALB. Recognizes ALB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

ALB Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Dog. This antibody is Unconjugated. Tested in the following application: ELISA

ALB Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200

ALB Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Macaca fascicularis. This antibody is Unconjugated. Tested in the following application: ELISA

ALB Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Goat. This antibody is Unconjugated. Tested in the following application: ELISA

ALB Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Guinea Pig. This antibody is Unconjugated. Tested in the following application: ELISA

ALB Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Pig. This antibody is Unconjugated. Tested in the following application: ELISA

ALB Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Canine. This antibody is Unconjugated. Tested in the following application: ELISA

ALB Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ALB. Recognizes ALB from Bovine. This antibody is Unconjugated. Tested in the following application: ELISA

ALB Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ALB. Recognizes ALB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:500-1:5000, WB:1:500-1:2000, IHC:1:25-1:100


ELA-E1459r 96 Tests
EUR 886

ALB sgRNA CRISPR Lentivector (Human) (Target 2)

K0070303 1.0 ug DNA
EUR 154

Alb sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4366103 1.0 ug DNA
EUR 154

Alb sgRNA CRISPR Lentivector (Rat) (Target 2)

K6931503 1.0 ug DNA
EUR 154

ALB Conjugated Antibody

C38231 100ul
EUR 397

ALB Conjugated Antibody

C35541 100ul
EUR 397


HY-111398 100mg
EUR 1772

ALB Polyclonal Antibody

ES8512-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ALB from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

ALB Polyclonal Antibody

ES8512-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ALB from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Eukaryotic Albumin (ALB)

  • EUR 279.20
  • EUR 178.00
  • EUR 772.00
  • EUR 324.00
  • EUR 548.00
  • EUR 250.00
  • EUR 1780.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: D3ZEU5
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 66.5kDa
  • Isoelectric Point: 5.7
Description: Recombinant Human Albumin expressed in: Yeast

Albumin (ALB) Antibody

abx117086-100ug 100 ug
EUR 467
  • Shipped within 5-10 working days.

ALB Polyclonal Antibody

ABP57519-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from ALB at AA range: 511-560
  • Applications tips:
Description: A polyclonal antibody for detection of ALB from Human. This ALB antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from ALB at AA range: 511-560

ALB Polyclonal Antibody

ABP57519-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from ALB at AA range: 511-560
  • Applications tips:
Description: A polyclonal antibody for detection of ALB from Human. This ALB antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from ALB at AA range: 511-560

ALB Polyclonal Antibody

ABP57519-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from ALB at AA range: 511-560
  • Applications tips:
Description: A polyclonal antibody for detection of ALB from Human. This ALB antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from ALB at AA range: 511-560

Albumin (ALB) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Albumin (ALB) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Albumin (ALB) Antibody

abx159323-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

Albumin (ALB) Antibody

  • EUR 871.00
  • EUR 453.00
  • 1 mg
  • 200 ug
  • Please enquire.

Albumin (ALB) Antibody

  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Albumin (ALB) Antibody

  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Albumin (ALB) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Albumin (ALB) Antibody

  • EUR 300.00
  • EUR 704.00
  • EUR 356.00
  • EUR 154.00
  • EUR 244.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Albumin (ALB) Antibody

  • EUR 258.00
  • EUR 133.00
  • EUR 551.00
  • EUR 300.00
  • EUR 230.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Albumin (ALB) Antibody

  • EUR 286.00
  • EUR 133.00
  • EUR 690.00
  • EUR 356.00
  • EUR 244.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Albumin (ALB) Antibody

  • EUR 467.00
  • EUR 133.00
  • EUR 1358.00
  • EUR 648.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Albumin (ALB) Antibody

  • EUR 467.00
  • EUR 133.00
  • EUR 1358.00
  • EUR 648.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Albumin (ALB) Antibody

  • EUR 467.00
  • EUR 133.00
  • EUR 1386.00
  • EUR 648.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Albumin (ALB) Antibody

  • EUR 481.00
  • EUR 133.00
  • EUR 1442.00
  • EUR 676.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Albumin (ALB) Antibody

abx032860-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Albumin (ALB) Antibody

abx032860-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Albumin (ALB) Antibody

abx025443-100ul 100 ul
EUR 523
  • Shipped within 5-10 working days.

Albumin (ALB) Antibody

abx025444-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Albumin (ALB) Antibody

abx025444-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Albumin (ALB) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Albumin (ALB) Antibody

  • EUR 1177.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Albumin (ALB) Antibody

  • EUR 1302.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Albumin (ALB) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Albumin (ALB) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Albumin (ALB) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

ALB Polyclonal Antibody

A56619 100 µg
EUR 570.55
Description: kits suitable for this type of research

ALB Polyclonal Antibody

A55898 100 µg
EUR 570.55
Description: fast delivery possible

ALB Rabbit pAb

A15638-100ul 100 ul
EUR 308

ALB Rabbit pAb

A15638-200ul 200 ul
EUR 459

ALB Rabbit pAb

A15638-20ul 20 ul
EUR 183

ALB Rabbit pAb

A15638-50ul 50 ul
EUR 223

Anti-ALB Antibody

EUR 479

ALB Polyclonal Antibody

46741-100ul 100ul
EUR 252

ALB Polyclonal Antibody

46741-50ul 50ul
EUR 187

ALB Blocking Peptide

DF6396-BP 1mg
EUR 195

ALB cloning plasmid

CSB-CL001561HU1-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1884
  • Sequence: atgaagtgggtaacctttatttcccttctttttctctttagctcggcttattccaggggtgtgtttcgtcgagatgcacacaagagtgaggttgctcatcggtttaaagatttgggagaagaaaatttcaaagccttggtgttgattgcctttgctcagtatcttcagcagtgtc
  • Show more
Description: A cloning plasmid for the ALB gene.

ALB cloning plasmid

CSB-CL001561HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1191
  • Sequence: atgaagtgggtaacctttatttcccttctttttctctttagctcggcttattccaggggtgtgtttcgtcgagatgcacacaagagtgaggttgctcatcggtttaaagatttgggagaagaaaatttcaaagccttggtgttgattgcctttgctcagtatcttcagcagtgtc
  • Show more
Description: A cloning plasmid for the ALB gene.

Native Albumin (ALB)

  • EUR 315.04
  • EUR 187.00
  • EUR 906.40
  • EUR 368.80
  • EUR 637.60
  • EUR 274.00
  • EUR 2116.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): Inquire
  • Isoelectric Point: Inquire
Description: Recombinant Bovine Albumin expressed in: Bovine

Native Albumin (ALB)

  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 69kDa
  • Isoelectric Point: Inquire
Description: Recombinant Dog Albumin expressed in: Dog

Native Albumin (ALB)

  • EUR 315.04
  • EUR 187.00
  • EUR 906.40
  • EUR 368.80
  • EUR 637.60
  • EUR 274.00
  • EUR 2116.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): Inquire
  • Isoelectric Point: Inquire
Description: Recombinant Goat Albumin expressed in: Goat

Native Albumin (ALB)

  • EUR 368.80
  • EUR 202.00
  • EUR 1108.00
  • EUR 436.00
  • EUR 772.00
  • EUR 310.00
  • EUR 2620.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 69kDa
  • Isoelectric Point: Inquire
Description: Recombinant Horse Albumin expressed in: Horse

Native Albumin (ALB)

  • EUR 232.61
  • EUR 165.00
  • EUR 597.28
  • EUR 265.76
  • EUR 431.52
  • EUR 218.00
  • EUR 1343.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 69.9kDa
  • Isoelectric Point: 5.5
Description: Recombinant Chicken Albumin expressed in: E.coli

Native Albumin (ALB)

  • EUR 216.48
  • EUR 161.00
  • EUR 536.80
  • EUR 245.60
  • EUR 391.20
  • EUR 208.00
  • EUR 1192.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: D3ZEU5
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 66.4KD
  • Isoelectric Point: Inquire
Description: Recombinant Human Albumin expressed in: Human

Native Albumin (ALB)

  • EUR 171.68
  • EUR 149.00
  • EUR 368.80
  • EUR 189.60
  • EUR 279.20
  • EUR 178.00
  • EUR 772.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): Inquire
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Albumin expressed in: Mouse

Native Albumin (ALB)

  • EUR 306.08
  • EUR 185.00
  • EUR 872.80
  • EUR 357.60
  • EUR 615.20
  • EUR 268.00
  • EUR 2032.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): Inquire
  • Isoelectric Point: Inquire
Description: Recombinant Pig Albumin expressed in: Pig

Native Albumin (ALB)

  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: PBS, pH 7.4
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): Inquire
  • Isoelectric Point: Inquire
Description: Recombinant Pig Native Albumin (ALB) expressed in: Pig

Native Albumin (ALB)

  • EUR 153.76
  • EUR 144.00
  • EUR 301.60
  • EUR 167.20
  • EUR 234.40
  • EUR 166.00
  • EUR 604.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): Inquire
  • Isoelectric Point: Inquire
Description: Recombinant Rat Albumin expressed in: Rat

Native Albumin (ALB)

  • EUR 162.72
  • EUR 146.00
  • EUR 335.20
  • EUR 178.40
  • EUR 256.80
  • EUR 172.00
  • EUR 688.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 68.7kDa
  • Isoelectric Point: 6.1
Description: Recombinant Rabbit Albumin expressed in: Rabbit

Native Albumin (ALB)

  • EUR 306.08
  • EUR 185.00
  • EUR 872.80
  • EUR 357.60
  • EUR 615.20
  • EUR 268.00
  • EUR 2032.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): Inquire
  • Isoelectric Point: Inquire
Description: Recombinant Simian Albumin expressed in: Simian

Anti-ALB antibody

STJ97823 100 µl
EUR 234
Description: Mouse monoclonal to ALB.

Anti-ALB antibody

STJ98462 100 µl
EUR 234
Description: Mouse monoclonal to ALB.

Anti-ALB antibody

STJ98625 200 µl
EUR 197
Description: Rabbit polyclonal to ALB.

Anti-ALB antibody

STJ22574 100 µl
EUR 277
Description: Albumin is a soluble, monomeric protein which comprises about one-half of the blood serum protein. Albumin functions primarily as a carrier protein for steroids, fatty acids, and thyroid hormones and plays a role in stabilizing extracellular fluid volume. Albumin is a globular unglycosylated serum protein of molecular weight 65,000. Albumin is synthesized in the liver as preproalbumin which has an N-terminal peptide that is removed before the nascent protein is released from the rough endoplasmic reticulum. The product, proalbumin, is in turn cleaved in the Golgi vesicles to produce the secreted albumin.

Anti-ALB antibody

STJ22575 100 µl
EUR 277
Description: Albumin is a soluble, monomeric protein which comprises about one-half of the blood serum protein. Albumin functions primarily as a carrier protein for steroids, fatty acids, and thyroid hormones and plays a role in stabilizing extracellular fluid volume. Albumin is a globular unglycosylated serum protein of molecular weight 65,000. Albumin is synthesized in the liver as preproalbumin which has an N-terminal peptide that is removed before the nascent protein is released from the rough endoplasmic reticulum. The product, proalbumin, is in turn cleaved in the Golgi vesicles to produce the secreted albumin.

Anti-ALB antibody

STJ118099 100 µl
EUR 277

2-Propyl-β-D-glucuronide, 2 mg

0904-2 2 mg
EUR 162

Dog Albumin (ALB) Protein

  • EUR 217.00
  • EUR 175.00
  • EUR 356.00
  • EUR 230.00
  • EUR 203.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Albumin (ALB) Protein

abx670201-1mg 1 mg
EUR 314
  • Shipped within 1 week.

Human Albumin (ALB) Protein

  • EUR 411.00
  • EUR 217.00
  • EUR 1052.00
  • EUR 467.00
  • EUR 300.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Albumin (ALB) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse Albumin (ALB) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse Albumin (ALB) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Rat Albumin (ALB) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Dog Albumin (ALB) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Rabbit Albumin (ALB) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Rabbit Albumin (ALB) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Rat ALB shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EHA0035 96Tests
EUR 521


ELA-E1028h 96 Tests
EUR 824


EGTA0035 96Tests
EUR 521

Canine ALB ELISA Kit

ECA0035 96Tests
EUR 521

Chicken ALB ELISA Kit

ECKA0035 96Tests
EUR 521

Bovine ALB ELISA Kit

EBA0035 96Tests
EUR 521

Anserini ALB ELISA Kit

EAA0035 96Tests
EUR 521


EF001360 96 Tests
EUR 689


ERA0035 96Tests
EUR 521

Rabbit ALB ELISA Kit

ERTA0035 96Tests
EUR 521


ESA0035 96Tests
EUR 521

Porcine ALB ELISA Kit

EPA0035 96Tests
EUR 521

Monkey ALB ELISA Kit

EMKA0035 96Tests
EUR 521


EMA0035 96Tests
EUR 521

Pig Albumin (ALB) Protein

  • EUR 439.00
  • EUR 230.00
  • EUR 1191.00
  • EUR 509.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Serum Albumin (ALB) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serum Albumin (ALB) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serum Albumin (ALB) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serum Albumin (ALB) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serum Albumin (ALB) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serum Albumin (ALB) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serum Albumin (ALB) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serum Albumin (ALB) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serum Albumin (ALB) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serum Albumin (ALB) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serum Albumin (ALB) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serum Albumin (ALB) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serum Albumin (ALB) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serum Albumin (ALB) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serum Albumin (ALB) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serum Albumin (ALB) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cow Albumin (ALB) Protein

  • EUR 453.00
  • EUR 230.00
  • EUR 1233.00
  • EUR 523.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Goat Albumin (ALB) Protein

  • EUR 453.00
  • EUR 230.00
  • EUR 1233.00
  • EUR 523.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Albumin (ALB) Protein

  • EUR 300.00
  • EUR 203.00
  • EUR 746.00
  • EUR 342.00
  • EUR 258.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Albumin (ALB) Protein

  • EUR 244.00
  • EUR 189.00
  • EUR 523.00
  • EUR 272.00
  • EUR 217.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Pig Albumin (ALB) Protein

  • EUR 439.00
  • EUR 230.00
  • EUR 1191.00
  • EUR 509.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Rabbit Albumin (ALB) Protein

  • EUR 244.00
  • EUR 189.00
  • EUR 481.00
  • EUR 258.00
  • EUR 217.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Albumin (ALB) Protein

  • EUR 230.00
  • EUR 189.00
  • EUR 439.00
  • EUR 244.00
  • EUR 203.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Monkey Albumin (ALB) Protein

  • EUR 439.00
  • EUR 230.00
  • EUR 1191.00
  • EUR 509.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

human Albumin (ALB) Antibody

abx010373-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

Albumin (ALB) Antibody (APC)

  • EUR 1177.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Albumin (ALB) Antibody (Biotin)

  • EUR 537.00
  • EUR 258.00
  • EUR 1636.00
  • EUR 759.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Albumin (ALB) Antibody (Biotin)

  • EUR 509.00
  • EUR 258.00
  • EUR 1539.00
  • EUR 718.00
  • EUR 411.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Albumin (ALB) Antibody (FITC)

  • EUR 551.00
  • EUR 272.00
  • EUR 1706.00
  • EUR 787.00
  • EUR 439.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Albumin (ALB) Antibody (FITC)

  • EUR 509.00
  • EUR 258.00
  • EUR 1525.00
  • EUR 704.00
  • EUR 411.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Albumin (ALB) Antibody (FITC)

  • EUR 272.00
  • EUR 203.00
  • EUR 620.00
  • EUR 328.00
  • EUR 244.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Albumin (ALB) Antibody (FITC)

  • EUR 537.00
  • EUR 272.00
  • EUR 1664.00
  • EUR 773.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Albumin (ALB) Antibody (HRP)

  • EUR 495.00
  • EUR 258.00
  • EUR 1483.00
  • EUR 690.00
  • EUR 398.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Albumin (ALB) Antibody (FITC)

  • EUR 467.00
  • EUR 244.00
  • EUR 1386.00
  • EUR 648.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Albumin (ALB) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Albumin (ALB) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.